1. You are interested in amplifying the entirety of gene below. Design a forward and reverse primer to amplify this entire gene making sure each primer has ~18 nucleotides approximately. Do not include any restriction sites, kozak sequences or random nucleotides – just design the hybridization sequence of the primers. Make sure your final answer at the bottom is in the correct format and direction written in the 5’-3’ direction for BOTH primers. I left room under each line of sequence so you can write the complementary sequence to help you. ATGCAATTCTCTACTGTCGCTTCCGTTGCTTTCGTCGCTTTGGCTAACTTTGTTGCCGCT GAATCCGCTGCCGCCATTTCTCAAATCACTGACGGTCAAATCCAAGCTACTACCACTGCT ACCACCGAAGCTACCACCACTGCTGCCCCATCTTCCACCGTTGAAACTGTTTCTCCATCC AGCACCGAAACTATCTCTCAACAAACTGAAAATGGTGCTGCTAAGGCCGCTGTCGGTATG GGTGCCGGTGCTCTAGCTGCTGCTGCTATGTTGTTATAA a. Forward primer sequence to be ordered (4 pts): b. Reverse primer sequence to be ordered (4 pts):