(Solved): You performed a Sanger sequencing reaction and obtained the following chromatogram (a computer-gene ...

You performed a Sanger sequencing reaction and obtained the following chromatogram (a computer-generated trace of the intensity of each color's fluorescence). In this figure, $\mathbf{A}=$ green, $\mathbf{C}=$ purple, $\mathbf{G}=$ black, $\mathbf{T}=$ red. The height of the peaks is unimportant. The $5^{?}$ end of the sequence is at the left of the trace. -What is the sequence of the template DNA used for this sequencing reaction? (You can still answer the question even if you cannot distinguish the different colors.) 5 3' TTTGCTTTGTGAGCGGATAACAA 5' 3' AAACGAAACACTCGCCTATTGTT 5' 5' AAACGAAACACTCGCCTATTGTT 3' 5' TTTGCTTTGTGAGCGGATAACAA 3'