Expert Answers

The coriolis effect causes the ekman spiral, which in turn creates ocean gyres.

Nitrosylsulfuric acid, HSO5N, can be formed by reacting HNO2 with H2SO4 under cold conditions. HNO2 (aq) + H2SO4 (aq) ? HSO5N (aq) + H2O (l) This is an exothermic reaction. Which of the following changes to a chemical system of the reaction above at equilibrium would cause it to shift right (i.e. promote the formation of more product)? Group of answer choices Increasing the external pressure Adding NaOH (a strong base) Removing some HNO2 Adding additional H2SO4 Increasing the temperature

What is the angle of rotation for a regular octagon?

Which of the following statements is NOT true? Models that include only the natural factors of solar variability and volcanoes accurately model the current warming trend The most accurate GCMs include both anthropogenic and natural factors The IPCC Fifth Assessment Report concluded with 99% confidence that humans are the strongest changers of climate since 1950 For RCP2.6, radiative forcing peaks before 2020 and declines before 2100 Current GCMs have resolutions as small as 60 miles

Which of the following statements regarding the grey matter in the spinal cord is FALSE? Group of answer choices General visceral afferent interneurons are located in the dorsal horn of grey matter Presynaptic parasympathetic neuronal soma are located in the lateral horns of C2-C4 spinal cord segments Presynaptic sympathetic neuronal soma are located in the lateral horns of T1-L2 spinal cord segments General somatic afferent interneurons are located in the dorsal horn of grey matter Lower motor neurons are located in the ventral horn of grey matter

3'GTACATGGTCCTATACAAGACGGATGTGATATGCTCACTCGTTTTCCGGATCGCTACATTGTAG 5' Transcribe and translate the gene using the space above (ignore the colored pieces for now). Please write the mRNA in 5’ to 3’ direction and the polypeptide in the N-terminal to C-terminal direction.

Which expression correctly describes the experimental probability,

, where

is the number of times event

occurred and

is the total number of trials,

, in the experiment? Select one: a.

b.

c.

d.

Under which accounting method are most income statement accounts translated at the average exchange rate for the period? Group of answer choices Current/noncurrent method Monetary/nonmonetary method Temporal method Current rate method

QUESTION The cerebellum is composed of the the

which is made of g ay matter. ANSWER

arbor vitac; cerebellar cortex arbor vitae; cerebral cortex cerebral cortex; arbor vitae cerebellar cortex; arbor vitae

Question 33 Which Cisco Unity Connection setting allows to determine the features that each user can use? Cos CoR css MWI